TBX1_d1
	A	C	G	T	Name	TBX1
1	6790	23	978	1855	TF group	TBX
2	1576	1003	6165	925	Polypeptide used	DBD
3	9	4	7564	26	Ligand sequence	TACGGA40NGGC
4	9	113	64	7491	Batch of SELEX experiment	AI
5	7	11	7557	15	Seed sequence	AGGTGTGAAAAAAGGTGTGA
6	58	414	37	7446	Hamming distance of sequences to seed	3
7	26	252	5703	1968	SELEX cycle	4
8	7584	7	5	0	Number of repeats	dimeric
9	7308	30	933	433	Comment
10	7158	349	937	1116	Representative matrix	yes
11	6258	671	830	2520
12	6787	1566	1036	1724
13	7379	3	302	239
14	1978	914	6353	1298
15	8	12	7526	49
16	392	416	31	7267
17	5	0	7581	0
18	353	299	18	7570	Source:
19	54	173	7545	1622	Jolma et al., Cell 152:327-339 (2013); PubMed 23332764
20	7565	26	32	7
	TBX1_d2
	A	C	G	T	Name	TBX1
1	6440	21	152	177	TF group	TBX
2	734	49	10018	94	Polypeptide used	DBD
3	5	4	9639	8	Ligand sequence	TACGGA40NGGC
4	22	50	167	8767	Batch of SELEX experiment	AI
5	2	1	10319	0	Seed sequence	AGGTGTGAAWTTCACACCT
6	41	184	51	8790	Hamming distance of sequences to seed	2
7	54	52	10256	74	SELEX cycle	4
8	6441	1	12	0	Number of repeats	dimeric
9	6108	550	32	548	Comment
10	2704	23	46	5169	Representative matrix	no
11	2694	46	171	6305
12	5	1	19	8744
13	193	6270	157	15
14	6163	30	280	99
15	2	6264	6	5
16	6551	22	30	0
17	4	6089	19	2	Source:
18	28	5643	149	786	Jolma et al., Cell 152:327-339 (2013); PubMed 23332764
19	27	279	33	8877
	TBX1_m1
	A	C	G	T	Name	TBX1
1	11931	113	1007	564	TF group	TBX
2	1560	711	11931	669	Polypeptide used	DBD
3	0	0	11931	0	Ligand sequence	TACGGA40NGGC
4	28	214	141	11931	Batch of SELEX experiment	AI
5	0	5	11931	0	Seed sequence	AGGTGTGA
6	142	613	109	11931	Hamming distance of sequences to seed	1
7	141	720	11931	1039	SELEX cycle	4
8	11931	33	18	0	Number of repeats	monomeric
					Comment
					Representative matrix	no
					Source:
					Jolma et al., Cell 152:327-339 (2013); PubMed 23332764
	TBX1_d3
	A	C	G	T	Name	TBX1
1	229	1869	1253	9297	TF group	TBX
2	233	687	83	11232	Polypeptide used	DBD
3	0	0	11	11922	Ligand sequence	TACGGA40NGGC
4	874	7686	661	10	Batch of SELEX experiment	AI
5	8701	3	2626	1	Seed sequence	TYTCACACCTNNNAGGTGTGARA
6	14	8413	22	8	Hamming distance of sequences to seed	2
7	8717	7	74	9	SELEX cycle	4
8	5	8399	7	3	Number of repeats	dimeric
9	106	8270	4	641	Comment
10	99	381	612	12029	Representative matrix	no
11	673	4775	684	3777
12	4794	458	504	4150
13	4062	351	6518	6
14	8908	44	47	8
15	613	99	9778	3981
16	3	0	13786	3
17	41	71	252	11972
18	7	5	13766	5
19	100	2654	33	8586
20	18	534	13241	335	Source:
21	8949	104	20	12	Jolma et al., Cell 152:327-339 (2013); PubMed 23332764
22	4221	36	7128	460
	TBX1_d4
	A	C	G	T	Name	TBX1
1	730	472	767	11227	TF group	TBX
2	9	7	56	12141	Polypeptide used	DBD
3	329	7981	573	4	Ligand sequence	TACGGA40NGGC
4	8622	2	178	216	Batch of SELEX experiment	AI
5	2	8154	20	3	Seed sequence	YTCACACCTNNAGGTGTGAR
6	8518	10	349	22	Hamming distance of sequences to seed	2
7	8	8298	22	5	SELEX cycle	4
8	1720	7767	108	636	Number of repeats	dimeric
9	182	484	296	11588	Comment
10	3223	4316	1047	126	Representative matrix	yes
11	2692	2274	257	4777
12	7009	1799	794	83
13	542	2525	9882	210
14	6	82	13640	1
15	16	136	150	11750
16	0	0	13953	1
17	243	128	93	11623
18	6	135	13381	688	Source:
19	8730	42	24	14	Jolma et al., Cell 152:327-339 (2013); PubMed 23332764
20	5372	97	4683	1455